Background information for interested pythonistas (not needed to solve the bite)

The DNA usually occurs as a double stranded molecule with the same information stored on both strands. Due to the chemical structures however, the "letters" (bases) on each strand are not identical to each other. Whenever the base A is present on one strand, then the opposite strand will possess a T. If a T is present on one strand, an A will be present on the other. The same rule applies to the bases G and C. A&T and G&C are therefore called complementary bases.

For DNA sequences, usually only the top strand will be given, as the lower strand can easily be deduced (see bite 259: reverse complement). Given the above sequence, the DNA in the cell would look like this:

UPPER AAAAAAAATTTTTTGGGGCC
      ||||||||||||||||||||
LOWER TTTTTTTTAAAAAACCCCGG

counts upper: A=8, T=6, G=4, C=2, TOTAL = 20
  GC content = n(G|C) / n(A|C|G|T) = 6/20 = 3/10 => 30%
counts lower: T=8, A=6, C=4, G=2, TOTAL = 20
  GC content = n(G|C) / n(A|C|G|T) = 6/20 = 3/10 => 30%

The GC content is identical on both strands! This explains why we only have to inspect one strand to calculate the total GC content and not both. In addition it also explains why the GC and not e.g. GA or TG content are used. Consider the above sequence again to calculate the GA content instead:

UPPER AAAAAAAATTTTTTGGGGCC
      ||||||||||||||||||||
LOWER TTTTTTTTAAAAAACCCCGG

counts upper: A=8, T=6, G=4, C=2, TOTAL = 20
  GA content = n(G|A) / n(A|C|G|T) = 12/20 = 6/10 => 60%
counts lower: T=8, A=6, C=4, G=2, TOTAL = 20
  GA content = n(G|A) / n(A|C|G|T) = 8/20 = 4/10 => 40%
Overall:
  GA content = n(G|A) / n(A|C|G|T) = 12+8/40 = 20/40 => 50%

The GA, GT, CA and CT contents of DNA will always be 50%! The only alternative would be the AT content but scientists chose the GC content as a convention.